lyophilized powder is one of those subjects where the details matter more than the headlines. This page pulls together the background, the mechanisms, and the practical points readers ask about most.
Last reviewed on 2026-04-11. Where a claim depends on a specific study, the study is described rather than over-claimed.
Identity and purity are usually assessed by reversed-phase high-performance liquid chromatography, which separates the target peptide from truncated or oxidised impurities. Mass spectrometry, most often coupled to liquid chromatography, confirms molecular mass and detects substitutions that chromatography alone may miss. Amino acid analysis and peptide mapping supply additional structural evidence, while nuclear magnetic resonance is reserved for full structural confirmation. Laboratories that examine samples sold online report wide variation in actual content, with some vials containing little or none of the labelled material.
Melanotan-2 appears on the World Anti-Doping Agency prohibited list within the peptide hormone class, and several national regulators treat it as an unapproved prescription substance. Some countries restrict importation or sale for personal use. Because the compound is widely traded as a research chemical, the practical legal picture differs between jurisdictions and shifts over time. Human safety data covering long periods are limited, and whether repeated pigmentation changes carry any lasting risk to melanocytes remains an open question.
Outside regulated medicine, melanotan II circulates through online vendors as a research chemical, often marketed for tanning. Products sold this way vary widely in purity, concentration, and labeling accuracy, and independent testing has documented discrepancies. Published reports describe both pigment effects and adverse reactions, including nausea, flushing, and darkening of existing moles. Long-term safety data are sparse, and no large controlled trial has established a risk profile. Questions about cumulative effects on melanocytes remain unresolved in the literature.
Melanotan II is a synthetic peptide analog modeled on alpha-melanocyte-stimulating hormone, a naturally occurring signaling peptide involved in pigmentation. Its structure is a cyclic heptapeptide containing two non-natural substitutions, norleucine at position four and D-phenylalanine at position seven. These modifications resist enzymatic breakdown and extend the molecule's activity relative to the native hormone. The compound binds melanocortin receptors and is studied mainly as a pharmacological tool rather than a therapeutic product. It has never received approval as a medicine in any major jurisdiction.
The compound was developed in the late 1980s and 1990s by academic researchers investigating photoprotection. The rationale held that stimulating melanin production might reduce ultraviolet damage to skin and lower skin cancer risk. Early work examined receptor binding, pigment response, and short-term tolerability in small studies. That program did not produce an approved drug, and formal development stalled after early-phase trials. Whether induced pigmentation confers meaningful photoprotection remains an open question.
| Property | Value | Notes |
|---|---|---|
| Typical storage temperature | -20 °C or below | For the lyophilised powder, desiccated |
| Storage form | Sealed vial, protected from light | Amber glass or foil-wrapped containers |
| Reconstituted stability | Short, refrigerate | Degradation accelerates in solution |
| Typical analytical method | Reversed-phase HPLC with mass spectrometry | Purity assessment plus identity confirmation |
| Common synonyms | Melanotan II, MT-II | Also written melanotan-2 |
Independent verification is central to quality control because the compound is not produced under pharmaceutical manufacturing standards. Third-party laboratories can measure purity, identity, residual solvents, and microbial contamination, though the scope of testing varies between services. Reported analyses of vendor samples have shown batch-to-batch variation in peptide content and the presence of truncated or oxidized species. How much of this variation reflects synthesis conditions versus storage and shipping is not well characterized. No harmonized reference standard exists for the material as sold.
Handling guidance for melanotan II follows general practice for small synthetic peptides rather than a product-specific monograph. Lyophilized powder is typically kept at minus twenty degrees Celsius or colder, protected from light and moisture, because warmth and humidity accelerate degradation. Once reconstituted, solutions are usually refrigerated and used within a short window, as hydrolysis and microbial growth both become concerns. Repeated freeze-thaw cycles are generally avoided. These conventions come from laboratory peptide chemistry and not from formal stability studies on this specific compound.
Structurally, Melanotan-2 retains the core recognition motif of alpha-melanocyte-stimulating hormone while adding a lactam bridge that links two side chains and constrains the molecule into a ring. This modification lowers susceptibility to enzymatic degradation. The compound acts as an agonist at melanocortin receptors, particularly subtypes associated with melanin production. Because the same receptor family influences several physiological processes, researchers note that its activity is not confined to pigmentation alone. Receptor selectivity continues to be examined in published studies.
Melanotan-2 is a synthetic cyclic heptapeptide designed as an analogue of alpha-melanocyte-stimulating hormone, a naturally occurring peptide involved in pigmentation signalling. Its sequence incorporates modified residues that increase potency and extend biological activity relative to the native hormone. The compound binds receptors of the melanocortin family and is examined mainly in laboratory research. It does not occur naturally and exists only as a manufactured chemical entity produced by solid-phase synthesis.
The peptide was developed during the 1980s by researchers investigating melanocortin signalling and skin pigmentation pathways. Early work focused on analogues of alpha-melanocyte-stimulating hormone that would resist enzymatic breakdown more effectively than the parent molecule. Melanotan-2 emerged from that programme as a shortened, cyclised variant. Reports describing its synthesis and receptor activity later appeared in the scientific literature. Commercial availability grew through unregulated channels rather than through pharmaceutical approval.
Heparin, also known as unfractionated heparin (UFH), is a medication and naturally occurring glycosaminoglycan. It is one of the most studied sulfated polysaccharides. Heparin is a blood anticoagulant that increases the activity of antithrombin. It is used in the treatment of heart attacks and unstable angina. It can be given intravenously or by injection under the skin. Its anticoagulant properties make it useful to prevent blood clotting in blood specimen test tubes and kidney dialysis machines. Common side effects include bleeding, pain at the injection site, and low blood platelets. Serious side effects include heparin-induced thrombocytopenia. Greater care is needed in those with poor kidney function. Heparin is contraindicated for suspected cases of vaccine-induced pro-thrombotic immune thrombocytopenia (VIPIT) secondary to SARS-CoV-2 vaccination, as heparin may further increase the risk of bleeding in an anti-PF4/heparin complex autoimmune manner, in favor of alternative anticoagulant medications (such as argatroban or danaparoid). Heparin appears to be relatively safe for use during pregnancy and breastfeeding. Heparin is produced by basophils and mast cells in all mammals. The discovery of heparin was announced in 1916. It is on the World Health Organization's List of Essential Medicines. A fractionated version of heparin, known as low molecular weight heparin, is also available.
=== Other methods === Favorskii rearrangement of α-haloketones in presence of base Baeyer–Villiger oxidation of ketones with peroxides Pinner reaction of nitriles with an alcohol Nucleophilic abstraction of a metal–acyl complex Hydrolysis of orthoesters in aqueous acid Cellulolysis via esterification Ozonolysis of alkenes using a work up in the presence of hydrochloric acid and various alcohols. Anodic oxidation of methyl ketones leading to methyl esters. Interesterification exchanges the fatty acid groups of different esters.
Ptosis or sagging of the female breast is a natural consequence of aging. The rate at which a woman's breasts drop and the degree of ptosis depends on many factors. The key factors influencing breast ptosis over a woman's lifetime are cigarette smoking, her number of pregnancies, higher body mass index, larger bra cup size, and significant weight change. Post-menopausal women or people with collagen deficiencies may experience increased ptosis due to a loss of skin elasticity. Many women and medical professionals mistakenly believe that breastfeeding increases sagging. It is also commonly believed that the breast itself offers insufficient support and that wearing a bra prevents sagging, which has not been found to be true. Plastic surgeons categorize the degree of ptosis by evaluating the position of the nipple relative to the infra-mammary fold, the point at which the underside of the breasts attach to the chest wall. In the most advanced stage, the nipples are below the fold and point toward the ground. Women's breasts undergo changes in size, volume, and position throughout their lives. In young women with large breasts—or even breast hypertrophy—sagging can occur early on due to the effects of gravity. The primary cause is often a disproportion between breast volume/weight and body size.
People who have ancestry from Sub-Saharan Africa, Asia, or Latin America are more likely to develop a keloid. Among ethnic Chinese in Asia, the keloid is the most common skin condition. In the United States, keloids are more common in African Americans and Hispanic Americans than European Americans. Those who have a family history of keloids are also susceptible since about 1/3 of people who get keloids have a first-degree blood relative (mother, father, sister, brother, or child) who also gets keloids. This family trait is most common in people of African and/or Asian descent. The development of keloids among twins also lends credibility to the existence of a genetic susceptibility to develop keloids. Marneros et al. (1) reported four sets of identical twins with keloids; Ramakrishnan et al. also described a pair of twins who developed keloids at the same time after vaccination. Case series have reported clinically severe forms of keloids in individuals with positive family history and black African ethnic origin.
Iodine-125 (125I) is a radioisotope of iodine which has uses in biological assays, nuclear medicine imaging and in radiation therapy as brachytherapy to treat a number of conditions, including prostate cancer, uveal melanomas, and brain tumors. It is the second longest-lived radioisotope of iodine, after iodine-129. Its half-life is 59.392 days and it decays by electron capture to an excited state of tellurium-125. This state is not the metastable 125mTe, but a much shorter-lived excited state that decays either by (7% chance) emitting a gamma ray with energy of 35 keV, or more likely (93% chance), undergoing internally conversion and ejecting an electron (of lower energy than 35 keV). The resulting electron vacancy leads to emission of characteristic X-rays (27–32 keV) and Auger electrons (50 to 500 eV). In either case stable ground state 125Te is the product. In medical applications, the internal conversion and Auger electrons cause little damage outside the cell which contains the isotope atom. The X-rays and gamma rays are of low enough energy to deliver a higher radiation dose selectively to nearby tissues, in "permanent" brachytherapy where the isotope capsules are left in place (125I competes with palladium-103 in such uses). Because of its relatively long half-life and emission of low-energy photons which can be detected by gamma-counter crystal detectors, 125I is a preferred isotope for tagging antibodies in radioimmunoassay and other gamma-counting procedures involving proteins outside the body.
Sources: en.wikipedia.org
On 24 March, Israel or its allies shot down an Iranian missile crossing above Lebanon at high altitude, according to the Lebanese army, which also confirmed that the missile was not targeting Lebanon. This was the first time during the current conflict when a shootdown of an Iranian missile took place over Lebanese territory. A US strike on the Habbaniya military base—which hosts units from the Popular Mobilization Forces—in Al Anbar Governorate killed seven members of the Iraqi Armed Forces and injured 13 others. In response, Iraqi prime minister Mohammed Shia' al-Sudani summoned the US embassy's chargé d'affaires in Baghdad. Iranian state media threatened that Iran could seize Bahraini and Emirati territory if the US "makes any mistakes", while signaling its readiness to open a new front in Yemen by closing the Bab al-Mandab Strait together with the Houthis. Israel said it killed Iran's top naval commander, Alireza Tangsiri, purportedly as part of an effort to reopen the Strait of Hormuz, which Katz said Tangsiri was "directly responsible" for the closure of. On 27 March, a day after Trump and Hegseth announced the "neutralization" of Iran's military, an Iranian missile and drone strike on Prince Sultan Air Base damaged several US refueling aircraft and injured at least 15 US soldiers. An E-3 Sentry was also damaged by the strike. Military analyst Cedric Leighton described the attack as a "a serious blow to [US] surveillance capabilities". The same day, Iran blocked two Chinese ships from entering the strait and sought to formalize fees for ships passing through it.
===== OECD ===== During an address to Argentine businesspeople in October 2024, Peña stated that one of the principal goals of his government is for Paraguay to become a member of the Organisation for Economic Co-operation and Development (OECD). He explained that, to achieve this goal, it is essential to continue promoting development in key areas such as education and security.
Petroleum in some form has been used since ancient times. More than 4,300 years ago, bitumen was mentioned when the Sumerians used it to make boats. A tablet of the legend of the birth of Sargon of Akkad mentions a basket which was closed by straw and bitumen. More than 4,000 years ago, according to Herodotus and Diodorus Siculus, asphalt (bitumen) was used in the construction of the walls and towers of Babylon; there were oil pits near Ardericca and Babylon and a pitch spring on Zakynthos. In Babylon, petroleum was used for road construction, ship caulking, and medicine. The use of petroleum in ancient China dates back more than 2,000 years. The I Ching, one of the earliest Chinese writings, cites that oil in its raw state, without refining, was first discovered, extracted, and used in China in the 1st century BCE. In addition, the Chinese were the first to record the use of petroleum as fuel as early as the 4th century BCE. By 347 CE, oil was produced from bamboo-drilled wells in China. In the 7th century, petroleum was among the essential ingredients for Greek fire, an incendiary projectile weapon that was used by Byzantine Greeks against Arab ships attacking Constantinople. Crude oil was distilled by Persian chemists, with clear descriptions given in Arabic handbooks such as those of Abu Bakr al-Razi. In the 9th century, oil fields were exploited in the area around modern Baku, Azerbaijan. These fields were described by Abu Bakr al-Razi in the 10th century and by Marco Polo in the 13th century, who describes the output of those wells as hundreds of shiploads.
=== Polyadenylation === Based on software analysis of the mRNA sequences various polyadenylation patterns could be identified for the transcription variants . TV1 and TV2 share the same pattern located on exon 10 starting at position 1246 resulting in a 32 nucleotide motif (AGUAGAGUCUGCGCUGUGACCUUCUGUUGGGC). TV3 uses a motif on exon 11 at the position 320. The motif is also 32 nucleotides long, but differs from the sequence used by TV1/2 (AGUGGCUUGUUCCACCUCAGCUCCCAUCUAAC). The difference in the polyadenylation sequence results in a variance of the minimum free energy values of the predicted RNA folding structures (-28.70 kcal/mol, TV1 and TV2 and -16.03 kcal/mol, TV3), which could result in different length of the Poly-A tail. Based on the observation that stable secondary structures result in decreased polyadenylation of the specific site, this might indicate that TV1 and TV2 are less polyadenylated in comparison to TV3.
== Mode of action == When used as a food additive, ractopamine added to feed can be distributed by the blood to the muscle tissues, where it serves as a full agonist to murine (mouse or rat) TAAR1, a receptor protein (not necessarily in humans). It is also an agonist to beta-adrenergic receptors and a dopamine releasing agent. A cascade of events will then be initiated to increase protein synthesis, which results in increased muscle fiber size. Ractopamine is known to increase the rate of weight gain, improve feed efficiency, and increase carcass leanness in finishing swine. Its use in finishing swine yields about 3 kg (6.6 lb) of additional lean pork per animal, and improves feed efficiency by 10%. In cattle on 28 January 2004 Elanco Animal Health made Optaflexx commercially available in the US. Optaflexx is a "medicated feed additive that is labeled only for use in steers or market heifers (not breeding heifers or bulls) during the last 28–42 days on feed."
Sources: en.wikipedia.org
=== 20 May === Eighteen Russian Shahed drones were launched at Kyiv. According to the Ukrainian Air Force all eighteen were shot down. Falling debris set fire to the roof of a residential complex in the Dniprovskyi District. This was the eleventh attack on the capital during the month of May. The Ukrainian Air Force also claimed to have destroyed two drones in the country's "east" and one in the "south" without further details. Yevgeny Prigozhin claimed on Telegram that his Wagner mercenaries had completely captured Bakhmut. This was denied by Ukraine, which nevertheless called the situation in the city "critical". The Russian Defence Ministry later confirmed the capture of the city, with President Putin sending his congratulations. Ukrainian President Volodymyr Zelenskyy met with Indian Prime Minister Narendra Modi at the G7 summit in Hiroshima for the first time since the Russian invasion of Ukraine. Pyotr Kucherenko, deputy science and higher education minister of the Russian Federation, suddenly fell ill on a plane returning from a business trip to Cuba. The aircraft landed at Mineralnye Vody however doctors were unable to save the minister's life. Kucherenko had reportedly called the war in Ukraine a "fascist invasion" in private. Exiled journalist Roman Super spoke to him "days before" his death, where Kucherenko expressed fears for his safety. The minister also had a preexisting heart condition.
The dependence of medical care on the meat industry assumed threatening proportions in the wake of the COVID-19 pandemic. In 2020, several studies demonstrated the efficacy of heparin in mitigating severe disease progression, as its anticoagulant effect counteracted the formation of immunothrombosis. However, the availability of heparin on the world market was decreased, because concurrently a renewed swine flu epidemic had reduced significant portions of the Chinese hog population. The situation was further exacerbated by the fact that mass slaughterhouses around the world became coronavirus hotspots themselves and were forced to close temporarily. In less affluent countries, the resulting heparin shortage also led to worsened health care beyond the treatment of COVID-19, for example through the cancellation of cardiac surgeries.
HBTU (hexafluorophosphate benzotriazole tetramethyl uronium) is a coupling reagent used in solid phase peptide synthesis. It was introduced in 1978 and shows resistance against racemization. It is used because of its mild activating properties. HBTU is prepared by reaction of hydroxybenzotriazole with TCFH under basic conditions and was assigned to a uronium type structure, presumably by analogy with the corresponding phosphonium salts, which bear a positive carbon atom instead of the phosphonium residue. Later, it was shown by X-ray analysis that salts crystallize as guanidinium rather than the corresponding uronium salts.
Between 400 and 1200 AD, Arab traders introduced opium to China, and to India by 700 AD. The physician Muhammad ibn Zakariya al-Razi of Persian origin ("Rhazes", 845–930 CE) maintained a laboratory and school in Baghdad, and was a student and critic of Galen; he made use of opium in anesthesia and recommended its use for the treatment of melancholy in Fi ma-la-yahdara al-tabib, "In the Absence of a Doctor", a home medical manual directed toward ordinary citizens for self-treatment if a doctor was not available. The renowned Andalusian ophthalmologic surgeon Abu al-Qasim al-Zahrawi ("Abulcasis", 936–1013 CE) relied on opium and mandrake as surgical anesthetics and wrote a treatise, al-Tasrif, that influenced medical thought well into the 16th century. The Persian physician Abū 'Alī al-Husayn ibn Sina ("Avicenna") described opium as the most powerful of the stupefacients, in comparison to mandrake and other highly effective herbs, in The Canon of Medicine. The text lists medicinal effects of opium, such as analgesia, hypnosis, antitussive effects, gastrointestinal effects, cognitive effects, respiratory depression, neuromuscular disturbances, and sexual dysfunction. It also refers to opium's potential as a poison. Avicenna describes several methods of delivery and recommendations for doses of the drug. This classic text was translated into Latin in 1175 and later into many other languages and remained authoritative until the 19th century. Şerafeddin Sabuncuoğlu used opium in the 14th-century Ottoman Empire to treat migraine headaches, sciatica, and other painful ailments.
Efficacy was based on DESTINY-Breast03 (NCT03529110), a multicenter, open-label, randomized trial that enrolled 524 participants with HER2-positive, unresectable, and/or metastatic breast cancer who received prior trastuzumab and taxane therapy for metastatic disease or developed disease recurrence during or within six months of completing neoadjuvant or adjuvant therapy. Participants were randomized 1:1 to receive either trastuzumab deruxtecan or trastuzumab emtansine by intravenous infusion every three weeks until unacceptable toxicity or disease progression. Randomization was stratified by hormone receptor status, prior treatment with pertuzumab, and history of visceral disease. The FDA approved trastuzumab deruxtecan for the treatment of HER2-low breast cancer based on DESTINY-Breast04, a randomized, multicenter, open label clinical trial that enrolled 557 adult participants with unresectable or metastatic HER2-low breast cancer. The trial included two cohorts: 494 hormone receptor positive (HR+) participants and 63 hormone receptor negative (HR-) participants. Of these participants, 373 randomly received trastuzumab deruxtecan by intravenous infusion every three weeks and 184 randomly received physician's choice of chemotherapy (eribulin, capecitabine, gemcitabine, nab paclitaxel, or paclitaxel). The results showed improvement in both progression-free survival and overall survival in people with unresectable or metastatic HER2-low breast cancer.
Sources: en.wikipedia.org
The lyophilised solid is best kept cold, dry and dark, typically at minus twenty degrees Celsius. Moisture and repeated warming cycles are the main causes of degradation. Solutions prepared from the powder are less stable and are normally used quickly.
Reversed-phase liquid chromatography assesses purity, while mass spectrometry confirms molecular mass and detects sequence errors. Amino acid analysis and peptide mapping add structural detail. These techniques are complementary rather than interchangeable.
It is listed as a prohibited peptide hormone by the World Anti-Doping Agency. No medicines regulator has approved it for human use. Import and sale rules vary by country.
It is a synthetic cyclic peptide designed as an analog of alpha-melanocyte-stimulating hormone. It acts on melanocortin receptors and is best known from research into pigmentation. It is not an approved pharmaceutical product.